Are stable producer cells the future of viral vector manufacturing and when will allogeneic cell therapy take hold? – BioPharma-Reporter.com

The publication, based on data generated from a questionnaire with 150 industry representatives, explores the challenges and solutions facing cell and gene therapy (CGT) companies over the next few years.

The top six trends identified in the CRB survey were:

We got the inside track from Noel Maestre, director of SlateXpace, a CRB solution focused on suite-based manufacturing platforms for the Advanced Therapy Medicinal Products (ATMP) and Peter Walters, CRBs director of ATMP, on how the CGT landscape is likely to develop in the short-term.

In a recent report, the MITs Center for Biomedical Innovationprojected that around 500,000 patients will have been treated with 40-60 approved gene therapies by 2030.

Going from the current scenario whereby only a few gene therapies are approved to 60 launches in a decade would represent an extraordinary leap forward and would dramatically change how medicine is actually perceived, said Maestre.

But as regards CGT production today, especially autologous cell therapy (ACT) work, he said that while the science exists the technology - process equipment, facility design and automation platforms - is really still trying to catch up, endeavoring to address a sector that has exploded in the past five years, he commented.

Looking ahead at the CGT landscape over the next few years, he expects a significant amount of change. The science is evolving we see the industry moving away from old cell lines to new cell lines or moving away from viral vectors altogether and using cleavage enzymes as a gene editing tool.

A new host cell line stable producer lines is gaining momentum, he said.

We are seeing the industry moving towards suspension cell culture from less than optimal cell lines, and then further going into producer cell lines.

A full 65% of respondents to the CRB poll said they are developing or intend to develop this type of vector host cell, drawn by the potential for a less expensive, more scalable process.

CRB: Our survey findings provide a data-driven snapshot of an industry whose intellectual capital and cutting-edge science is too often betrayed by outdated technology and applications ill-suited for commercial scale at a time when demand for urgent therapies is rising.

Once the industry gets to the point where producer cell lines are more like a name brand, easier to pull off the shelf and use, it will be a much more cost-effective way to produce viral vectors.

But we are right on the cusp - a lot of companies are recognizing the opportunity and are investing the time and money into producing these. And we also see a lot of contract development and manufacturing organizations (CDMOs) producing their own cell lines in house and using those as a lure to [attract the clinical material work] of their clients, said Walters.

According to Maestre, and the CRB survey data backs him up, the product pipelines of companies operating in the CGT space are going to get more complex, for the next five years at least.

More than half of those polled indicated they expect to adopt a multimodal solution within the next two years, with flexibility, scalability, operational efficiency, and speed to market as the top drivers.

Every company is going to be dealing with this dilemma of whether they build dedicated spaces for each of their different modalities, or whether they build highly flexible facilities that can allow them to accommodate whatever is coming next, said Maestre.

He also sees a lot more companies wanting to integrate their supply chain, bringing a lot of manufacturing in-house whereas before they would have been reliant on a whole set of different CDMOs and manufacturers.

Project delivery is also where change is occurring.

We are seeing the industry really moving away from the way projects were executed in the past into a much more integrated model; they are looking for turnkey facility delivery and they want turnaround to be faster. COVID-19 has only accentuated that, with project timelines compressed by 30-40%, and I dont think that it is ever going back to the way it was I think that is going to become the standard, commented Maestre.

And another major trend over the next few years will be around the cost of therapies. As they become more commonplace and there are more and more CGT licensed products, the costs will come down.

Projecting forward, Walters sees an eventual shift away from autologous to allogeneic cell therapy.

As the technology continues to develop and the science continues to improve and new and better ways are found to use and leverage cells, we will see companies moving to a scalable allogeneic model, getting away from having to do that point-of-care, personalized tracking and more towards a classic manufacturing model that allows them to produce cells in advance in a way that they can be scaled up.

The idea, evidently, is to process cells for not one but dozens of patients at a time.

We see the industry moving towards donated cells for allogeneic therapy and we are also seeing the beginnings of a shift to using stem cells that can be genetically modified and scaled up and differentiated to become T-Cells or NK cells. I dont think industry has settled on a course yet but there are a lot of companies trying to find that pathway, trying to find the edge to move their manufacturing platform that way, remarked Walters.

Right now, though, all facets of CGT manufacturing are under pressure from COVID-19 vaccine production, they said.

There is significant shortage of cleanroom manufacturing space to manufacture and develop the almost 1,200 CGT products in clinical trials currently.

What we are seeing is that CDMOs have so much demand - they have 12-18 months of backlog in terms of contracts for product development so they are building [new facilities] very rapidly.

As owner operator companies are stuck with that delay in getting their products into development, they are also developing a significant amount of manufacturing space on their own. But while both branches are building as fast as they can, it still isnt enough.

We are constantly hearing from our clients that they are concerned about their supply chains and being able to secure their material. Right now, a lot of companies are moving towards a combination of using CDMOs and manufacturing in-house, said Maestre.

CRB is a provider of engineering, architecture, construction and consulting solutions to the global life sciences and advanced technology industries, with over 1,300 employees.

Read more:

Are stable producer cells the future of viral vector manufacturing and when will allogeneic cell therapy take hold? - BioPharma-Reporter.com

Read more
Mini kidneys bioprinted in the lab – Lab + Life Scientist

Researchers from the Murdoch Childrens Research Institute (MCRI) and biotech company Organovo have used cutting-edge technology to bioprint miniature human kidneys in the lab, paving the way for new treatments for kidney failure and possibly lab-grown transplants. Their study has been published in the journal Nature Materials.

Like squeezing toothpaste out of a tube, extrusion-based 3D bioprinting uses a bioink made from a stem cell paste, squeezed out through a computer-guided pipette to create artificial living tissue in a dish. According to MCRI Professor Melissa Little, a world leader in modelling the human kidney, this new bioprinting method is faster and more reliable than previous methods, allowing the whole process to be scaled up. 3D bioprinting could now create about 200 mini kidneys in 10 minutes without compromising quality.

From larger than a grain of rice to the size of a fingernail, bioprinted mini kidneys fully resemble a regular-sized kidney, including the tiny tubes and blood vessels that form the organs filtering structures called nephrons. Prof Little said the mini organs will be used to screen drugs to find new treatments for kidney disease or to test if a new drug was likely to injure the kidney.

Drug-induced injury to the kidney is a major side effect and difficult to predict using animal studies; bioprinting human kidneys are a practical approach to testing for toxicity before use, she said.

In the study, researchers tested the toxicity of aminoglycosides a class of antibiotics that commonly damage the kidney. Prof Little said, We found increased death of particular types of cells in the kidneys treated with aminoglycosides.

By generating stem cells from a patient with a genetic kidney disease, and then growing mini kidneys from them, also paves the way for tailoring treatment plans specific to each patient, which could be extended to a range of kidney diseases.

Prof Little said the study also showed that 3D bioprinting of stem cells can produce large enough sheets of kidney tissue needed for transplants. She noted, 3D bioprinting can generate larger amounts of kidney tissue but with precise manipulation of biophysical properties, including cell number and conformation, improving the outcome.

Prof Little said prior to this study the possibility of using mini kidneys to generate transplantable tissue was too far away to contemplate, but that may no longer be the case.

The pathway to renal replacement therapy using stem cell-derived kidney tissue will need a massive increase in the number of nephron structures present in the tissue to be transplanted, she said.

By using extrusion bioprinting, we improved the final nephron count, which will ultimately determine whether we can transplant these tissues into people.

Image credit: stock.adobe.com/au/bluebay2014

Please follow us and share on Twitter and Facebook. You can also subscribe for FREE to our weekly newsletters and bimonthly magazine.

Read the original here:

Mini kidneys bioprinted in the lab - Lab + Life Scientist

Read more
Researchers make ‘exciting first step’ to better understanding development and treatment of autism – BioPharma-Reporter.com

The authors of a paper, published in the journalScience, in an attempt tostudy the function of genes implicated in autism spectrum disorders (ASDs), applied a gene-editing and single-cellsequencing system, Perturb-Seq, to knock out 35 ASD candidate genes in multiple mice embryos.

They described how the Perturb-Seq method they developed can investigate the function of many different genes in many different cell types at once.

Directing the large-scale method to the study of dozens of genes that are associated with ASD, they identified how specific cell types in the developing mouse brain are impacted by mutations.

"The field has been limited by the sheer time and effort that it takes to make one model at a time to test the function of single genes. Now, we have shown the potential of studying gene function in a developing organism in a scalable way, which is an exciting first step to understanding the mechanisms that lead to autism spectrum disorder and other complex psychiatric conditions, and to eventually develop treatments for these devastating conditions," co-senior author Paola Arlotta, the Golub Family Professor of Stem Cell and Regenerative Biology at Harvard.

The method is also broadly applicable to other organs, enabling scientists to better understand a wide range of disease and normal processes, she said.

The study was also led by co-senior authors Aviv Regev, who was a core member of the Broad Institute during the study and is currently executive vice president of Genentech research and early development, and Feng Zhang, a core member of the Broad Institute and an investigator at MIT's McGovern Institute.

"Through genome sequencing efforts, a very large number of genes have been identified that, when mutated, are associated with human diseases. Traditionally, understanding the role of these genes would involve in-depth studies of each gene individually. By developing Perturb-seq for in vivo applications, we can start to screen all of these genes in animal models in a much more efficient manner, enabling us to understand mechanistically how mutations in these genes can lead to disease," said Zhang, who is also the James and Patricia Poitras Professor of Neuroscience at MIT and a professor of brain and cognitive sciences and biological engineering at MIT.

According to the World Health Organization (WHO), the global burden of ASD is continuously growing, with a current prevalence rate of 1 in 160 children.

Reported prevalence rates vary widely from country to country though, according to apaper published in Nature.

Data from the US Centers for Disease Control and Prevention shows that about 1 in 68 children in the US had been identified with some form of ASD, with more than 3 million people affected.A study referenced in the Nature report estimates that the prevalence of ASD in the US in 20142016 was 2.47% among adolescents and children, while in the UK, the annual prevalence rate for children aged 8 years between 2004 and 2010 was 3.8/1000 for boys and 0.8/1000 for girls.

That paper also indicated recent studies showing the pooled ASD prevalence estimate in Asia is 0.36%, including data from nine countries: China, Korea, India, Bangladesh, Lebanon, Iran, Israel, Nepal and Sri Lanka, while the prevalence of ASD in the Middle East region was documented to be 1.4 per 10,000 children in Oman, 4.3 per 10,000 children in Bahrain, and 1/167 in Saudi Arabia.

Moreover, ASD incidence is four to five times greater in males than in females, according to the Nature report.

To investigate gene function at a large scale, the researchers said they combined two powerful genomic technologies. They used CRISPR-Cas9 genome editing to make precise changes, or perturbations, in 35 different genes linked to autism spectrum disorder risk. Then, they analyzed changes in the developing mouse brain using single-cell RNA sequencing, which allowed them to see how gene expression changed in over 40,000 individual cells.

By looking at the level of individual cells, the researchers could compare how the risk genes affected different cell types in the cortex - the part of the brain responsible for complex functions including cognition and sensation. They analyzed networks of risk genes together to find common effects.

"We found that both neurons and glia - the non-neuronal cells in the brain - are directly affected by different sets of these risk genes," said Xin Jin, lead author of the study and a Junior Fellow of the Harvard Society of Fellows. "Genes and molecules don't generate cognition per se - they need to impact specific cell types in the brain to do so. We are interested in understanding how these different cell types can contribute to the disorder."

To get a sense of the model's potential relevance to the disorder in humans, the researchers compared their results to data from post-mortem human brains. In general, they found that in the post-mortem human brains with autism spectrum disorder, some of the key genes with altered expression were also affected in the Perturb-seq data.

"We now have a really rich dataset that allows us to draw insights, and we're still learning a lot about it every day," Jin said. "As we move forward with studying disease mechanisms in more depth, we can focus on the cell types that may be really important."

See the original post:

Researchers make 'exciting first step' to better understanding development and treatment of autism - BioPharma-Reporter.com

Read more
Cryopreservation Equipment in Stem Cells Market 2020 Growth By Manufacturers, Type And Application, Forecast To 2026 : Thermo Fisher Scientific,…

A newly added research report by Orbis Pharma Reports evaluating various developments and eventful milestones in global Cryopreservation Equipment in Stem Cells market suggests that the aforementioned market is an emerging one with ample scope for refurbishments and developments. Inclined to render optimum investment guidance for accurate pandemic management, this versatile research report also sheds ample light on COVID-19 pandemic management and evolution guide to emerge successfully from limitations that have stunned growth progression substantially. Thorough research offerings compiled by Orbis Phrama Reports suggest that owing to favorable market conditions and rampant market opportunities in the previous decades, several market participants have directed investment aggressively towards novelties.This in-depth research report initiated by Orbis Pharma Reports equips readers with ample market advantages, allowing manufacturers to spot crucial cues pertaining to market rivalry, competition intensity. The report also allows readers to gauge into technological innovations to enable diffusion of technological advances into market investments, thus deriving maximum benefits.

Get sample copy of Cryopreservation Equipment in Stem Cells Market report @ https://www.orbispharmareports.com/sample-request/73922

Segment Identification:

This detailed market synopsis by Orbis Pharma Reports depicting current market scenario highlights crucial details on SWOT analysis, PESTEL analysis and Porters Five Forces analytical reviews to understand market developments in real time. Market Relevant information have been professed with great detail in the report to encourage high investment returns by leading players in global Cryopreservation Equipment in Stem Cells market. The report carries out a deep analytical study to identify and understand the potential of core factors that stimulate high end growth.This high-end research report assessing the market scenario lends ample insights on various market facets concerning market segments. The segmentation concerning global Cryopreservation Equipment in Stem Cells market identifies product and service categories as vital segments. Additional segments also include applications and geographical expanse as prominent market segments harnessing revenue diversifications which also have been evaluated with great detail in this Orbis Pharma Reports presentation. This segment intensive information presented in the report influence competitive edge amongst report readers and inquisitive market participants.

Major Company Profiles operating in the Cryopreservation Equipment in Stem Cells Market:

Thermo Fisher ScientificpraxairCharter MedicalsLinde Gas Cryoservices

Read complete report along with TOC @ https://www.orbispharmareports.com/global-cryopreservation-equipment-in-stem-cells-market-insight-and-forecast-to-2026/

Regional Developments: an Overview:

In the following report sections, research analysts at Orbis Pharma Reports reveal an overview of various geographical developments that play crucial role in growth enablement. Several prominent growth beds available across varied regions have been identified in detail to understand vendor preferences and investment discretion besides tapping on novel growth opportunities prevalent across different regions.Across MEA, South Africa and GCC countries demonstrate promising growth potential. European nations such as Germany, Italy, France and Scandinavian countries offer immense growth potential. Across APAC, countries such as Australia, Southeast Asian countries, India, Japan, and China are likely to remain afloat. Further in regional segmentation, Orbia Pharma Reports identifies Canada and the US to remain most favorable growth beds.

By the product type, the market is primarily split into

Liquid PhaseVapor Phase

By the application, this report covers the following segments

Totipotent Stem CellPluripotent Stem Cell

The following is a brief of some of the most insightful report offerings, vital to deploy appropriate business decisions in global Cryopreservation Equipment in Stem Cells market to influence market stability and revenue generation.1.Orbis Pharma Reports sketches a thorough analytical demonstration of the global Cryopreservation Equipment in Stem Cells market, inclusive of versatile details on current market trends and futuristic growth estimations2.The report lends a versatile perspective of market growth influencers that allow in comprehending key market trends harnessing lucrative foothold amidst staggering competition3.The report by Orbis Pharma Reports also ensures a systematic DROT assessment with elaborate references of market manacles and growth initiators besides hovering over ample market opportunities and novel avenues.4.Additional details on overall remunerative value and market competencies have also been minutely identified to ensure stability and sustenance in this unique market research documentation by Orbis Pharma Reports .5.Advanced research and analytical practices such as PORTERs Five Forces analytical methods have been followed to understand trade competencies of buyer and supplier terrains.

For Any Query on the Cryopreservation Equipment in Stem Cells Market: https://www.orbispharmareports.com/enquiry-before-buying/73922

About Us :

At Orbispharma we curate the most relevant news stories, features, analysis and research reports on the important challenges undertaken by the pharmaceutical and related sectors. Our editorial philosophy is to bring you sharp, focused and informed perspective of industries, the end users and application of all upcoming trends into the pharma sector. Orbispharma believes in conversations that can bring a change in one of the most crucial economic sectors in the world. With these conversations we wish our customers to make sound business decisions with right business intelligence.

Contact Us :

Excerpt from:

Cryopreservation Equipment in Stem Cells Market 2020 Growth By Manufacturers, Type And Application, Forecast To 2026 : Thermo Fisher Scientific,...

Read more
Histogen Announces Preliminary Week 18 HST-001 Study Results for the Treatment of Androgenic Alopecia in Men – StreetInsider.com

As you were browsing http://www.streetinsider.com something about your browser made us think you were a bot.

If you are interested in http://www.streetinsider.com content, APIs are available. Please contact us here http://www.streetinsider.com/signup_content.php

After completing the CAPTCHA below, you will immediately regain access to http://www.streetinsider.com.

Read the original here:

Histogen Announces Preliminary Week 18 HST-001 Study Results for the Treatment of Androgenic Alopecia in Men - StreetInsider.com

Read more
US FDA Approves Naxitamab for the Treatment of Neuroblastoma – OncoZine

The U.S. Food and Drug Administration (FDA) has approved naxitamab* (naxitamab-gqgk; Danyelza; Y-mAbs Therapeutics), a humanized form of the mouse antibody 3F8, in combination with granulocyte-macrophage colony-stimulating factor (GM-CSF), for the treatment of pediatric patients 1 year of age and older and adult patients with relapsed or refractory high-risk neuroblastoma in the bone or bone marrow who have demonstrated a partial response (PR), minor response (mR), or stable disease (SD) to prior therapy.[1]

A rare diseaseNeuroblastoma is a heterogeneous pediatric neoplasm that arises in the sympathetic nervous system. The disease is the most common extra-cranial solid tumor in infants and children, representing between 8%-10% of all childhood tumors. Overall, neuroblastoma accounts for approximately 15% of all cancer-related deaths in children. [1]

The clinical behavior of neuroblastoma is highly variable, with some tumors being easily treatable, resulting in near-uniform survival. The majority of tumors are, however, very aggressive, with a high risk of death. [2] Age, stage, and amplification of the MYCN oncogene are the most validated prognostic markers.[2]

The incidence of neuroblastoma is 10.2 cases per million children under 15 years of age. [3] In the United States, nearly 700 new cases are reported each year. While 90% of cases are diagnosed before the age of 5, approximately 30% of patients are diagnosed within the first year. The median age of diagnosis is 22 months. [4]

Neuroblastoma develops in very early forms of nerve cells that are usually found in a developing baby, which explains why children as young as newborns can develop this cancer.

The disease rarely presents in adolescence and adulthood, but outcomes are much poorer in this age group. There does not appear to be an increased prevalence among races, but there is a slight predilection for males (1.2:1).[4]

Neuroblastoma develops in a part of the peripheral nervous system called the sympathetic nervous system. Since some of the sympathetic nervous system cells are concentrated in the adrenal glands, which sit above the kidneys, neuroblastoma often starts growing there. Tumors typically begin in the belly, neck, chest, pelvis, or adrenal glands and can spread to other parts of the body, including the bones.

All patients are staged based on the International Neuroblastoma Staging System Committee (INSS) system, ranging from stage 1 through stage 4S. Based on this staging system, patients with stage 4 disease diagnosed after one year of age are classified in the high-risk category, where the neuroblastoma tumor cells have already metastasized to other sites in the body, such as the bone or bone marrow.

Essentially all patients who have tumors with many copies, or amplification, of the MYCN oncogene also have high-risk disease, even if they do not have evidence of the tumor having spread.

Although children with a family history of neuroblastoma may have a higher risk for developing this disease, this factor accounts for only 1-2 % of all cases of neuroblastoma. The vast majority of children who develop the tumor, do not have a family history of the same.

Mechanism of actionIn simple terms, naxitamab, conceived and developed by physician-scientist Nai-Kong Cheung, M.D., Ph.D., a medical oncologist at Memorial Sloan Kettering ** who heads the organizations neuroblastoma program, detects neuroblastoma cells that have survived chemo- or radiation therapy by attaching to GD2, a ganglioside that is ubiquitously expressed in the plasma membrane of neuroblastoma and is shed into the circulation, after which the patients own immune system, especially white blood cells, can destroy the malignant neuroblastoma cells. [5]

In the late 1980s, investigators at Memorial Sloan Kettering started using 3F8 in combination with surgery and chemotherapy to treat patients diagnosed with neuroblastoma. The investigational treatment significantly improved cure rates for pediatric patients with high-risk disease.

Later, in 2007, Cheung and colleagues began developing a humanized form of 3F8 called Hu3F8. In August 2011 the researchers started a phase I study of Hu3F8 (NCT01419834). The study was designed to investigate the best and safest dose to give to patients.

Accelerated approval The new indication of naxitamab + GM-CSF is approved under accelerated approval regulation based on overall response rate and duration of response. Continued approval for this indication may be contingent upon verification and description of clinical benefits in a confirmatory trial.

Naxitamab is a humanized, monoclonal antibody that targets the ganglioside GD2, which is highly expressed in various neuroectoderm-derived tumors and sarcomas. The drug is administered to patients three times per week in an outpatient setting and the treatment is repeated every four weeks. The product has received Priority Review, Orphan Drug, Breakthrough Therapy, and Rare Pediatric Disease designations from the FDA.

Much needed treatmentOver the last decades, the development of novel treatments for pediatric cancers has been successful. For example, the five-year survival rates for children diagnosed with cancer in the late 1980s approaches 70%. For some types of localized embryonal tumors, including retinoblastoma and Wilms tumor, the cure rates approach or exceed 90%.

However, for every two children who survive today, one child still succumbs to their disease. And for some childhood cancers, such as neuroblastoma and certain types of brain cancer, the prognosis remains poor. Hence, despite the observed successes, there remained a major unmet medical need remains patients diagnosed with neuroblastoma. The development and subsequent approval of naxitamab may be one much-needed treatment options for these patients. [6]

[The approval represents a major milestone] for children living with refractory/relapsed high-risk neuroblastoma, noted Thomas Gad, founder, Chairman, and President of Y-mAbs Therapeutics, whose own daughters neuroblastoma was successfully treated with 3F8 at Memorial Sloan Kettering more than a decade ago.

In 2015, Memorial Sloan Kettering licensed Hu3F8 to Y-mAbs Therapeutics tpo expand the clinical trial and development program and manufacturing of naxitamab.

Its very exciting to see this treatment go from being an experimental therapy used at my daughters bedside to now being FDA approved, Gad added.

We believe that naxitamab in combination with GM-CSF is a much-needed treatment for patients with relapsed/refractory high-risk neuroblastoma in the bone or bone marrow who have historically not had approved treatments available. This approval of Y-mAbs first BLA represents a key step in working towards our mission of becoming a world leader in developing better and safer antibody-based oncology products addressing unmet pediatric and adult medical needs, said Claus Moller, Y-mAbs Therapeutics Chief Executive Officer.

Clinical trialsThe FDA approval of naxitamab is supported by clinical evidence from two pivotal studies in patients with high-risk neuroblastoma with refractory or relapsed disease.

In these clinical studies, naxitamab appears to be well tolerated with few discontinuations of treatment. The observed treatment-related adverse events were clinically manageable.

The efficacy of naxitamab in combination with GM-CSF was evaluated in two open-label, single-arm trials in patients with high-risk neuroblastoma with refractory or relapsed disease in the bone or bone marrow.

Both trials included patients with relapsed or refractory neuroblastoma in the bone marrow or bone. Participating patients received a 3 mg/kg of naxitamab intravenously on days one, three, and five of each four-week cycle, in addition to GM-CSF subcutaneously, or under the skin, at varying doses throughout the cycle. Patients were allowed to receive preplanned radiation in specific areas based on which trial they were enrolled in.

Efficacy outcomes included overall response rate (ORR) according to the revised International Neuroblastoma Response Criteria (INRC), as determined by independent pathology and imaging review and confirmed by at least one subsequent assessment. An additional efficacy outcome measure was the duration of response (DOR).

Study 201In the first study (Study 201; NCT03363373), a multicenter open-label, single-arm trial. researchers evaluated the combination of naxitamab in combination with GM-CSF in a subpopulation of patients who had refractory or relapsed high-risk neuroblastoma in the bone or bone marrow and demonstrated a partial response, minor response, or stable disease to prior therapy. Patients with progressive disease were excluded.

Of the 22 patients included in the efficacy analysis, 64% had refractory disease and 36% had relapsed disease. The median age was 5 years (range 3 to 10 years), 59% were male; 45% were White, 50% were Asian and 5% were Black.

MYCN amplification was present in 14% of patients and 86% of patients were International Neuroblastoma Staging System (INSS) stage 4 at the time of diagnosis. Disease sites included 59% in the bone only, 9% in bone marrow only, and 32% in both. Prior therapies included surgery (91%), chemotherapy (95%), radiation (36%), autologous stem cell transplant (ASCT) (18%), and anti-GD2 antibody treatment (18%).

Study 12-230The second study (Study 12-230; NCT01757626), a single-center, open-label, single-arm clinical trial, included a subpopulation of patients who had relapsed or refractory high-risk neuroblastoma in bone or bone marrow and demonstrated a partial response, minor response, or stable disease to prior therapy. In this study patients with progressive disease were excluded.

Participating patients received at least one systemic therapy to treat disease outside of the bone or bone marrow prior to enrollment. They were required to have received at least one dose of naxitamab at a dose of 3 mg/kg or greater per infusion and have evaluable disease at baseline according to independent review per the revised INRC. Radiation to non-target bony lesions and soft tissue lesions was permitted at the investigators discretion (assessment of response excluded sites that received radiation).

Of the 38 patients included in the efficacy analysis, 55% had relapsed neuroblastoma and 45% had refractory disease; 50% were male, the median age was 5 years (range 2 to 23 years), 74% were White, 8% Asian and 5% were Black, 5% Native American/American Indian/Alaska Native, 3% other races and 5% was not available. MYCN-amplification was present in 16% of patients and most patients were International Neuroblastoma Staging System (INSS) stage 4 (95%).

Fifty percent (50%) of patients had disease involvement in the bone only, 11% only in bone marrow, and 39% in both. Prior therapies included surgery (100%), chemotherapy (100%), radiation (47%), autologous stem cell transplant (ASCT) (42%), and anti-GD2 antibody treatment (58%)

Adverse eventsThe most common adverse reactions (incidence 25% in either trial) in patients receiving naxitamab were infusion-related reactions, pain, tachycardia, vomiting, cough, nausea, diarrhea, decreased appetite, hypertension, fatigue, erythema multiforme, peripheral neuropathy, urticaria, pyrexia, headache, injection site reaction, edema, anxiety, localized edema, and irritability.

The most common Grade 3 or 4 laboratory abnormalities (5% in either trial) were decreased lymphocytes, decreased neutrophils, decreased hemoglobin, decreased platelet count, decreased potassium, increased alanine aminotransferase, decreased glucose, decreased calcium, decreased albumin, decreased sodium, and decreased phosphate.

Boxed warningThe prescribing information for naxitamab contains a Boxed Warning which states that the drug can cause serious infusion-related reactions and neurotoxicity, including severe neuropathic pain, transverse myelitis, and reversible posterior leukoencephalopathy syndrome (RPLS). Hence, to mitigate these risks, patients should receive premedication prior to each naxitamab infusion and be closely monitored during and for at least two hours following completion of each infusion.

Note* Also known as humanized 3F8 or Hu3F8,** Researchers at Memorial Sloan Kettering Cancer Center (MSK) developed naxitamab, which is exclusively licensed by MSK to Y-mAbs. As a result of this licensing arrangement, MSK has institutional financial interests related to the compound and Y-mAbs.

Clinical trialsHumanized 3F8 Monoclonal Antibody (Hu3F8) in Patients With High-Risk Neuroblastoma and GD2-Positive Tumors NCT01419834Humanized 3F8 Monoclonal Antibody (Hu3F8) When Combined With Interleukin-2 in Patients With High-Risk Neuroblastoma and GD2-positive Solid Tumors NCT01662804Humanized Anti-GD2 Antibody Hu3F8 and Allogeneic Natural Killer Cells for High-Risk Neuroblastoma NCT02650648Study of the Safety and Efficacy of Humanized 3F8 Bispecific Antibody (Hu3F8-BsAb) in Patients With Relapsed/Refractory Neuroblastoma, Osteosarcoma and Other Solid Tumor Cancers NCT03860207Combination Therapy of Antibody Hu3F8 With Granulocyte- Macrophage Colony Stimulating Factor (GM-CSF) in Patients With Relapsed/Refractory High-Risk Neuroblastoma NCT01757626Naxitamab for High-Risk Neuroblastoma Patients With Primary Refractory Disease or Incomplete Response to Salvage Treatment in Bone and/or Bone Marrow NCT03363373

Highlights of prescription informationNaxitamab (naxitamab-gqgk; Danyelza; Y-mAbs Therapeutics) [Prescribing Information]

Reference[1] Park JR, Eggert A, Caron H. Neuroblastoma: biology, prognosis, and treatment. Hematol Oncol Clin North Am. 2010 Feb;24(1):65-86. doi: 10.1016/j.hoc.2009.11.011. PMID: 20113896.[2] Modak S, Cheung NK. Neuroblastoma: Therapeutic strategies for a clinical enigma. Cancer Treat Rev. 2010 Jun;36(4):307-17. doi: 10.1016/j.ctrv.2010.02.006. Epub 2010 Mar 12. PMID: 20227189.[3] Maris JM. Recent advances in neuroblastoma. N Engl J Med. 2010 Jun 10;362(23):2202-11. doi: 10.1056/NEJMra0804577. PMID: 20558371; PMCID: PMC3306838.[4] Esiashvili N, Anderson C, Katzenstein HM. Neuroblastoma. Curr Probl Cancer. 2009 Nov-Dec;33(6):333-60. doi: 10.1016/j.currproblcancer.2009.12.001. PMID: 20172369.[5] Balis FM, Busch CM, Desai AV, Hibbitts E, Naranjo A, Bagatell R, Irwin M, Fox E. The ganglioside GD2 as a circulating tumor biomarker for neuroblastoma. Pediatr Blood Cancer. 2020 Jan;67(1):e28031. doi: 10.1002/pbc.28031. Epub 2019 Oct 14. PMID: 31612589.[6] Balis FM. The Challenge of Developing New Therapies for Childhood Cancers. Oncologist. 1997;2(1):I-II. PMID: 10388032.

Featured image: A close up of a newborn babys foot in the neonatal unit in a hospital. Photo courtesy: 2016 2020 Fotolia/Adobe. Used with permission

View post:

US FDA Approves Naxitamab for the Treatment of Neuroblastoma - OncoZine

Read more
PBRM1 and the glycosylphosphatidylinositol biosynthetic pathway promote tumor killing mediated by MHC-unrestricted cytotoxic lymphocytes – Science…

INTRODUCTION

Cytotoxic lymphocytes (CLs) are subtypes of immune cells capable of detecting and killing tumor and virus-infected cells (1, 2). Current cancer immunotherapy mainly harnesses the antitumor activities of cytotoxic T cells, effectors of the adaptive immune system (25). T cells detect transformed cells by using their T cell receptors to recognize tumor neoantigens displayed on the major histocompatibility complex (MHC) class I proteins of tumor cells (68). T cellbased therapies such as checkpoint inhibitors substantially extend the survival of a subset of patients with cancer (35, 9). Many tumors, however, are unresponsive to checkpoint therapies, possibly because of defects in presentation of tumor antigens on MHC class I (2). Moreover, tumor cells that initially respond to checkpoint inhibitor therapies often develop acquired resistance, resulting in tumor relapses (2, 4). Therefore, additional immunotherapeutic strategies are needed to achieve sustained clinical benefits in a larger patient population.

Another class of tumor-killing CLs are MHC-unrestricted CLs, which include natural killer (NK) cells, effectors of the innate immune system, and NK-like cell lines (1014). Unlike T cells, MHC-unrestricted CLs kill tumor or virally infected cells without requiring prior activation by MHC-presented antigens (6, 15, 16). The absence of MHC class I on target cells serves as a strong activation signal for MHC-unrestricted CLs (1, 6, 10, 12, 17). As a result, MHC-unrestricted CLs are capable of detecting and destroying tumor cells resistant to T cellmediated attack, holding great promise as mono or combination immunotherapies (18, 19). However, the antitumor activities of MHC-unrestricted CLs have not been translated into significant clinical benefits to patients, likely because of escape mechanisms evolved by tumor cells to circumvent killing (19, 20). To improve the efficacy of MHC-unrestricted CLs in immunotherapy, it is critical to identify genes controlling the response of tumor cells to cytotoxicity.

In this work, we performed genome-wide genetic screens to uncover tumor-intrinsic genes that regulate tumor killing by MHC-unrestricted CLs. Our screens identified a large number of regulators that either promote or inhibit the response of tumor cells to killing. The screens isolated known mediators of NK cellmediated killing, but most of the identified genes were not previously linked to tumor killing. Multiple top-ranking genes in the screens belong to the glycosylphosphatidylinositol (GPI) anchor biosynthetic pathway, which is not involved in T cellmediated killing. Further analyses revealed that the GPI biosynthetic pathway is required for the activation and cytolytic granule secretion of CLs. Another critical regulator identified in the screens was PBRM1, a component of the SWI/SNF chromatin-remodeling complex. Notably, PBRM1 promotes the killing of tumor cells by MHC-unrestricted CLs, in contrast to its inhibitory activity in T cellmediated killing. Thus, PBRM1 plays opposite roles in MHC-restricted and MHC-unrestricted cytotoxicity. Like the GPI biosynthetic pathway, PBRM1 promotes cytolytic granule secretion in CLs. The factors identified in this work could represent potential targets for cancer immunotherapy.

We developed a tumor-killing platform using TALL-104 cells, a clinically relevant CL cell line exhibiting robust MHC-unrestricted cytotoxicity against human tumors (14, 18, 2123). Despite the T cell origin of this cell line, TALL-104 cells express NK cell receptors and closely resemble NK cells in recognizing and destroying tumors without prior sensitization (fig. S1) (14). Previously, TALL-104 cells have been used in clinical trials to treat patients with cancer (14, 18, 2124). A major advantage of TALL-104 cells is that they can be readily expanded into large homogeneous populations to meet the demands of genome-wide genetic screens. We observed that TALL-104 cells efficiently killed HAP1 cells (Fig. 1A and fig. S2A), a haploid human cell line derived from chronic myeloid leukemia cells (2527). By contrast, primary human cells, including peripheral blood mononuclear cells (PBMCs) and adipose stem cells (ASCs), were resistant to TALL-104mediated killing (Fig. 1A and fig. S2B), consistent with the ability of CLs to distinguish between tumor and normal cells (68).

(A) TALL-104 cells (CLs) kill HAP1 cells (tumor cells) but not normal cells. HAP1 cells and human PBMCs grown on a 24-well plate were treated with the indicated ratios of TALL-104 cells for 8 hours. The cells were stained with propidium iodide (PI) and measured by flow cytometry. Error bars indicate SD (n = 3). P values were calculated using Students t test. ***P < 0.001. n.s., P > 0.05. (B) Illustration of the genome-wide haploid genetic screen aiming to identify tumor-intrinsic genes required for TALL-104 cytotoxicity. (C) Bubble graph showing significant hits from the haploid genetic screen. The y axis depicts the log10 of P values for the gene hits in the TALL-104selected population as compared to a published unselected control (62) using Fishers exact test. Dashed line indicates the cutoff of significance. We set a P value cutoff of 1 105 to account for multiple hypothesis testing. In addition, for genes with P values less than 1 1010, we considered a gene as a hit only if it also had strong enrichment for sense-strand intron insertions based on the binomial test (P value cutoff: 1 105). The x axis depicts the chromosomal positions of the genes. The size of a circle is scaled according to the number of unique inactivating gene-trap insertions within the gene. Circles are colored according to the annotated or predicted functions of the gene products. Genes that did not reach the cutoff are shown in gray. Full datasets of the screen are included in table S1.

To systematically identify tumor-intrinsic genes required for TALL-104mediated killing, pooled HAP1 cells were randomly mutagenized using retroviral gene-trap insertions (2729). The mutagenized HAP1 cells were incubated with TALL-104 cells for four consecutive rounds, in which approximately 50% of the HAP1 cells were killed during each round (Fig. 1B). After the final round of killing, the TALL-104resistant HAP1 population was harvested, and their gene-trap retroviral insertions were mapped by deep sequencing. The gene-trap insertions were then compared to those of an untreated control HAP1 population to identify significant hits on the basis of the enrichment of inactivating gene-trap insertions.

The haploid genetic screen identified a number of genes that promote TALL-104mediated killing (Fig. 1C and table S1). Mutations of these genes in target cells caused resistance to TALL-104mediated cytotoxicity. One gene identified in the screen was NCR3LG1/B7H6, which encodes an activating ligand for the NK cell receptor NKp30 (Fig. 1C) (30). Another hit from the screen was PVR/CD155, which encodes a ligand for DNAX accessory molecule 1 (DNAM-1), another activating receptor on NK cells (Fig. 1C) (1012). Our screen also recovered IFNGR2, which encodes the interferon- (IFN-) receptor critical to NK cellmediated cytotoxicity (1012). Recovery of these known mediators of NK cell cytotoxicity strongly supports the physiological relevance of the screen and further demonstrates that TALL-104 cells resemble NK cells in tumor killing. Most of the hits, however, were not previously linked to CL-mediated killing.

Multiple genes identified in the screen, including PIGP, PIGS, PIGL, and GPAA1, encode enzymes responsible for the biosynthesis of the GPI moiety of GPI-anchored proteins (GPI-APs) (Fig. 1C) (28). Thus, the GPI anchor biosynthetic pathway is required for tumor cell sensitivity to TALL-104mediated cytotoxicity. Another top-ranking hit was PBRM1/BAF180, which encodes a subunit of the PBAF form of the SWI/SNF chromatin-remodeling complex (Fig. 1C) (31, 32). Other genes isolated in the screen encode factors involved in a range of cellular processes including membrane trafficking and gene expression (fig. S3).

Since a large fraction of the inactivating gene-trap insertions in the primary screen were within the GPI anchor biosynthetic genes (table S1), additional regulators might have been masked. To this end, we next performed a genome-scale modifier screen using GPI-deficient HAP1 cells. We used CRISPR-Cas9 genome editing to delete PIGP, a key gene in GPI anchor biosynthesis (28). Surface expression of the GPI-AP CD59 was abolished (Fig. 2A), confirming the loss of the GPI anchor in PIGP knockout (KO) cells. GPI anchordeficient HAP1 cells were still killed by TALL-104 cells, albeit with a significantly lower efficiency.

(A) Flow cytometry measurements of the surface levels of CD59, a GPI-AP used as a marker for the GPI pathway (CD59 is not involved in CL-mediated killing). PIGP KO HAP1 cells were generated using CRISPR-Cas9 genome editing. A lack of surface CD59 in pooled PIGP KO cells indicates that the GPI pathway was abolished. WT, wild-type. (B) Screen hits from the modifier haploid genetic screen using the PIGP KO HAP1 cells. The screen was performed as described in Fig. 1. The y axis depicts the log10 of P values for the gene hits in the TALL-104 selected population compared to the unselected control using Fishers exact test. We set a P value cutoff of 1 105 to account for multiple hypothesis testing. In addition, we considered a gene as a hit only if it also had strong enrichment for sense-strand intron insertions based on the binomial test (P value cutoff: 1 105). The x axis depicts the chromosomal positions of the genes. The size of the circle is scaled according to the number of unique inactivating gene-trap insertions with the gene. Circles are colored according to the annotated or predicted functions of the gene products. Dashed line indicates the cutoff of significance. Genes that did not reach the cutoff are shown in gray. Full datasets are included in table S2. (C) Lists of genes identified in the primary and modifier screens. Genes linked to cancer or CL killing are highlighted in bold. Cancer association is based on the COSMIC database.

The modifier screen using GPI anchordeficient cells recovered most of the hits from the primary screen including NCR3LG1, PVR, and IFNGR2 (Fig. 2, B and C), validating the critical roles of these genes in TALL-104mediated killing. As expected, none of the genes involved in GPI anchor biosynthesis were recovered in the modifier screen (Fig. 2, B and C; figs. S3 and S4; and table S2). The modifier screen identified many additional genes including TNFRSF10A and TNFRSF10B (Fig. 2, B and C), which encode TRAIL death receptors known to mediate CL-mediated killing (6, 10). These findings are consistent with roles of death receptors in NK cellmediated killing. Other genes identified in the modifier screen were not previously linked to tumor killing. Notably, a subset of the genes identified in the primary screen including PBRM1 were not recovered in the modifier screen (Fig. 2, B and C, and fig. S4), suggesting that these genes might be linked to the GPI biosynthetic pathway in TALL-104mediated killing.

Previous genetic screens dissected MHC-restricted tumor killing mediated by cytotoxic T lymphocytes (3335). Next, we compared the hits from our screens with those from T cellbased screens. The IFN- receptor was also recovered in T cell screens (3335), in agreement with the role of the IFN- pathway in both MHC-restricted and MHC-unrestricted cytotoxicity (8, 10, 12). However, most of the hits from our genetic screens, including the GPI biosynthetic genes, were not isolated in T cellbased screens (3335). Likewise, most genes identified in T cellbased screens were not recovered in our screens. In particular, a large portion of genes identified in T cellbased screens encode regulators of the MHC class I and PD-L1 (programmed cell death 1 ligand 1) pathways (3335). As expected, these genes were not recovered in our MHC-unrestricted screens (Fig. 2C and fig. S4). Notably, although PBRM1 was also isolated in T cellbased screens of tumor killing (35), its function is distinct: PBRM1 inhibits T cellmediated cytotoxicity but promotes TALL-104mediated killing (Fig. 1C) (35). Thus, PBRM1 plays both positive and negative roles in tumor killing. Together, these findings demonstrate differences between the regulatory networks underlying MHC-restricted and MHC-unrestricted cytotoxicity.

According to gene set enrichment analysis (GSEA) (36), the factors identified in our screens belong to multiple KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways and form physical or functional networks (figs. S5 and S6 and table S3). Approximately half of the hits identified in our screens were mutated in human cancers according to the Catalogue of Somatic Mutations in Cancer (COSMIC) database (Fig. 2C). Since these genes do not regulate cell growth (table S4), our data suggest that cancer-linked mutations in these genes may promote tumorigenesis by preventing NK cellmediated tumor killing.

Next, we sought to identify tumor-intrinsic genes encoding negative regulators of TALL-104mediated killing on the basis of depletion of inactivating gene-trap insertions. To accurately calculate gene-trap depletion from a large mutant cell population, we developed gene-trap strand profile (GSP), a scoring metric based on the numbers of unique inactivating (sense) or neutral (antisense) gene-trap insertions within the introns of a candidate gene. A negative GSP score represents the depletion of inactivating gene-trap insertions in a gene, corresponding to a detrimental effect of the gene KO on cell viability (fig. S7, A to C). As a proof of concept, we used the GSP scoring metric to identify the genes essential to the viability or growth of HAP1 cells in the absence of TALL-104 cells. Approximately 1788 essential genes were identified, encompassing all known essential pathways such as translation, transcription, and RNA splicing (fig. S7, D and E, and table S4). This list included virtually all the essential genes identified in previous genetic studies (26, 37), suggesting that GSP scores accurately quantify gene-trap depletions.

Subsequently, we identified genes with significantly negative GSP scores in TALL-104selected HAP1 cells but not in the passage control population. Mutations of these genes sensitize the tumor cells to TALL-104mediated killing, leading to the depletion of inactivating gene-trap insertions. Thus, these genes encode negative regulators of tumor killing by TALL-104 cells. One of the negative factors identified in both the primary and modifier screens was CFLAR (CASP8 and Fas-associated death domain protein (FADD)like apoptosis regulator) (Fig. 3A), a known inhibitor of TRAIL-mediated apoptosis (38, 39). Another negative factor identified in both the primary and modifier screens was MGA, a transcription factor not previously linked to CL-mediated cytotoxicity (Fig. 3A). The ratio of inactivating and neutral gene-trap insertions in CFLAR and MGA genes was approximately 1:1 in the absence of TALL-104 selection, indicating that CFLAR and MGA are not essential to cell growth (Fig. 3A). However, their inactivating gene-trap insertions were strongly depleted after TALL-104 selection (Fig. 3A), reflecting the inhibitory roles of these genes in TALL-104mediated killing. Other negative regulators identified in the screens encompass a range of biological pathways such as TRAIL signaling, transcriptional regulation, and membrane trafficking (Fig. 3, B and C). A group of negative regulators identified in the primary screen were also recovered in the modifier screen (Fig. 3B and fig. S8). Many others, however, were not isolated in the modifier screen (fig. S8 and tables S5 and S6). While a subset of the negative regulators such as CFLAR were also involved in T cellmediated killing (3335), most of the factors were not recovered in T cellbased screens of tumor killing, again highlighting the fundamental differences between MHC-unrestricted and MHC-restricted cytotoxicity.

(A) Visual representations of gene-trap insertions in CFLAR and MGA in the passage control (no TALL-104 selection), the primary screen, and the modifier screen. The gray boxes indicate exons, while the gray lines indicate introns. The gray arrows depict the directions of transcription. Chromosomal locations of inactivating, sense gene-trap insertions are shown in red, while chromosomal locations of neutral, antisense insertions are shown in blue. GSP is a new scoring metric based on the numbers of unique sense (inactivating) or antisense (neutral) gene-trap insertion within the introns of a candidate gene. GSP = [log2(S/A) log10(S A)], where S and A represent the numbers of sense and antisense gene-trap insertions, respectively. (B) Top: Color key of the heatmap. Bottom: Heatmap showing the genes with significantly negative GSP scores in both the primary and modifier screens but not in the passage control. The complete lists of genes are included in fig. S8 and tables S5 and S6. The GSP scores of the genes were quantile-normalized. Genes with significantly negative GSP scores in both screens were clustered using the Euclidean distance metric. Dashed gray lines represent the sample mean, while the solid gray lines represent each hits GSP score relative to the sample mean. The color of each bar represents the GSP score. Genes associated with cancer or CL killing are highlighted in bold. Cancer association is based on the COSMIC database. (C) Summary of the negative regulators identified in the primary and modifier screens based on annotated or predicted gene function. Full datasets are shown in tables S5 and S6.

Next, we sought to determine the molecular mechanism of the GPI anchor biosynthetic pathway in tumor killing. Deletion of the PIGP gene in HAP1 cells abrogated surface expression of GPI-APs (Figs. 2A and 4A and fig. S9A). We mixed the PIGP KO cells with wild-type (WT) HAP1 cells and examined their sensitivity to TALL-104mediated cytotoxicity in a competition assay, which accurately measures the proliferation and death of cell populations (40). We observed that the ratio of WT and PIGP KO cells did not change significantly during passage in the absence of TALL-104 cells (Fig. 4, A and B), confirming that PIGP mutations do not affect cell growth. By contrast, PIGP KO cells were strongly enriched after two rounds of TALL-104 treatment (Fig. 4, A and B). These data demonstrate that mutation of the GPI biosynthetic pathway in HAP1 cells causes resistance to TALL-104mediated killing, validating the result of our genetic screens. Likewise, mutation of PIGP in 786-O cells, a human renal cancer cell line (41), caused resistance of the cells to TALL-104mediated killing (Fig. 4C). Thus, the role of the GPI biosynthetic pathway in tumor killing is not limited to HAP1 cells.

(A) A mixed population of WT and PIGP KO HAP1 cells was either untreated or treated with TALL-104 cells. Negative surface staining of CD55, a GPI-AP not involved in CL-mediated killing, was used as a marker for PIGP KO cells. CD55+ WT cells and CD55PIGP KO cells were analyzed by flow cytometry. (B) Percentage of WT and PIGP KO HAP1 cells in the passage control or TALL-104treated population. (C) Percentage of WT and PIGP KO 786-O cells in the passage control or TALL-104treated population. CD55+ WT cells and CD55PIGP KO 786-O cells were quantified by flow cytometry after each round of treatment. Data in (B) and (C) are presented as mean values (n = 3). (D) Normalized surface levels of immune regulators on WT and PIGP KO HAP1 cells. (E) TALL-104 degranulation presented as normalized surface levels of LAMP1 on TALL-104 cells. (F) Normalized surface levels of TRAIL on TALL-104 cells. (G) Normalized surface levels of CD69 on TALL-104 cells. Data in (D) to (G) are presented as means SD (n = 3). P values were calculated using Students t test. n.s., P > 0.05. ***P < 0.001.

TALL-104mediated killing closely resembles NK cellmediated cytotoxicity (Figs. 1 and 2) (42). Next, we directly examined how PIGP KO cells respond to NK cellmediated cytotoxicity. Using a propidium iodide (PI) uptake assay, we observed that PIGP KO cells were substantially more resistant to killing by primary human NK cells (fig. S9B). Thus, mutation of the GPI biosynthetic pathway in target cells also impairs NK cellmediated cytotoxicity.

We then tested how the GPI biosynthetic pathway regulates tumor surface molecules required for MHC-unrestricted cytotoxicity. Both TRAIL receptor and PVR (Poliovirus receptor) regulate TALL-104mediated killing (Fig. 2) (15, 16). However, surface levels of these molecules were not reduced in PIGP KO cells (Fig. 4D), indicating that their functions are independent of the GPI biosynthetic pathway. We then examined UL16-binding proteins (ULBPs), ligands for the activating NK cell receptor NKG2D (19). Since multiple ULBP genes were simultaneously expressed in HAP1 cells (Fig. 4D), ULBPs were not recovered in our screens because of functional redundancy. ULBPs are GPI-APs containing a C-terminal GPI anchor, although a subset of ULBPs also have a transmembrane domain (43, 44). It has been suggested that the GPI anchor and transmembrane domain play redundant roles in ULBP surface localization and activation of NKG2D (43). However, we observed that surface expression of ULBPs was completely lost in PIGP KO cells (Fig. 4D). Thus, despite the presence of transmembrane domains, the GPI anchor is essential to surface expression of ULBPs.

Next, we examined how the GPI biosynthetic pathway in tumor cells influences the function of CLs after cell-cell interaction. A major route of CL-mediated killing involves the secretion of the cytolytic molecules granzyme and perforin (7, 10, 11), which occurs when cytolytic granules fuse with the plasma membrane of a CL (8, 45). To measure cytolytic granule secretion, we used a flow cytometrybased degranulation assay to quantify surface levels of lysosomal-associated membrane protein 1 (LAMP1; also known as CD107a), a cytolytic granule protein that is exposed to the cell surface after cytolytic granules fuse with the plasma membrane (Fig. 4E) (45, 46). LAMP1 is a specific marker for degranulation as the lysosome-like cytolytic granule is not involved in the trafficking of other cytotoxic molecules such as IFN- and death receptor ligands (4750). Using this degranulation assay, we observed that TALL-104 cells exhibited little surface LAMP1 expression in the absence of HAP1 cells (Fig. 4E), consistent with a lack of cytolytic granule secretion in unstimulated CLs. Incubation with HAP1 cells, however, strongly increased the surface levels of LAMP1 on TALL-104 cells (Fig. 4E). Notably, PIGP KO HAP1 cells induced minimal LAMP1 externalization on TALL-104 cells (Fig. 4E), demonstrating that these mutant cells were defective in triggering the secretion of cytolytic molecules.

Besides cytolytic molecules, death ligands such as TRAIL are also used by CLs to kill tumor cells (10, 51). Our screens recovered TRAIL receptors (TNFRSF10A and TNFRSF10B) as hits (Fig. 2, B and C). In the absence of target cells, TALL-104 cells exhibited low surface levels of TRAIL (Fig. 4F). Incubation with WT HAP1 cells strongly elevated surface TRAIL on TALL-104 cells, while PIGP KO HAP1 cells were largely defective in inducing TRAIL surface expression (Fig. 4F). We also examined IFN-, a cytokine released by CLs to promote tumor killing. We observed that similar amounts of IFN- were released from NK cells when they were incubated with WT or PIGP KO HAP1 cells (fig. S10). Thus, IFN- release is not dependent on the GPI biosynthetic pathway of tumor cells.

We then determined whether the GPI biosynthetic pathway regulates CL activation. We examined the surface expression of CD69, an activation marker of NK cells (52, 53). We observed that TALL-104 cells displayed low surface CD69 expression in the absence of HAP1 cells (Fig. 4G). Addition of WT HAP1 cells strongly elevated surface levels of CD69 on TALL-104 cells (Fig. 4G). By contrast, PIGP KO HAP1 cells were largely defective in inducing CD69 expression (Fig. 4G). Thus, PIGP is essential to the activation of TALL-104 cells by tumor cells, consistent with its roles in cytolytic granule secretion and TRAIL expression. Together, these data indicate that the GPI biosynthetic pathway of tumor cells is required for the activation and cytotoxic functions of MHC-unrestricted CLs, providing a molecular explanation for its activating role in MHC-unrestricted cytotoxicity.

We next characterized PBRM1, a subunit of the PBAF chromatin-remodeling complex mutated in a large number of human cancers (Figs. 2 and 5A) (31, 32, 54). To validate the functional role of PBRM1 in TALL-104mediated cytotoxicity, we deleted the PBRM1 gene in HAP1 cells using CRISPR-Cas9 (Fig. 5B). WT and PBRM1 KO HAP1 cells were mixed and subjected to multiple rounds of TALL-104 treatment in a competition assay. We observed that PBRM1 KO cells were significantly enriched after three rounds of TALL-104 treatment (Fig. 5, C and D). By contrast, the ratio of WT and PBRM1 KO cells did not change significantly during passage in the absence of TALL-104 selection (Fig. 5, C and D), confirming that PBRM1 KO did not affect cell growth (32, 55). These results demonstrate that deletion of the PBRM1 gene in target cells caused resistance to TALL-104mediated killing, validating the finding of our genetic screen. Next, we examined the sensitivity of the cells to primary human NK cells. While WT HAP1 cells were efficiently killed by NK cells, PBRM1 KO cells were substantially more resistant to killing (Fig. 5E), confirming the critical role of PBRM1 in NK cellmediated cytotoxicity.

(A) Visual representations of gene-trap insertions in the PBRM1 gene in the screens. The gray boxes indicate exons, and the gray lines indicate introns. The gray arrows depict the direction of transcription. (B) Immunoblot showing PBRM1 expression in WT HAP1 cells and a clonal PBRM1 KO HAP1 cell line. PBRM1 mRNA expression in these cells is shown in fig. S13. (C) WT (GFP+) and PBRM1 KO (GFP) cells in mixed populations were quantified by flow cytometry after three rounds of passage or TALL-104 treatment. (D) Percentage of WT and PBRM1 KO HAP1 cells in the passage control or TALL-104treated population. Data are presented as mean values (n = 3). (E) Percentage of propidium iodidepositive WT and PBRM1 KO HAP1 cells after treatment with primary human NK cells. (F) Mean surface levels of immune regulators on WT and PBRM1 KO HAP1 cells. (G) TALL-104 degranulation presented as normalized surface levels of LAMP1 on TALL-104 cells after incubation with target cells. (H) NK-92 degranulation presented as normalized surface levels of LAMP1 in NK-92 cells. Data in (E) to (H) are presented as means SD (n = 3). P values were calculated using Students t test. n.s., P > 0.05. *P < 0.05, **P < 0.01, ***P < 0.001.

Next, we further examined how PBRM1 regulates the response of tumor cells to killing. Since loss of MHC class I promotes killing by MHC-unrestricted CLs (19), the resistance of PBRM1 KO cells to killing could be due to up-regulation of MHC class I. However, we observed that surface levels of MHC class I molecules were moderately reduced in PBRM1 KO cells (fig. S11), indicating that the resistance of the KO cells to killing was not caused by up-regulation of MHC class I. Surface levels of TRAIL receptor and PVR were not significantly reduced in the KO cells (Fig. 5F). Mutation of PBRM1 markedly decreased surface expression of ULBPs in HAP1 cells (Fig. 5F). Thus, like PIGP, PBRM1 broadly regulates surface expression of ULBPs in target cells. The overall similarity of PIGP and PBRM1 KO phenotypes prompted us to examine whether PBRM1 regulates cytolytic granule secretion. Using the flow cytometrybased degranulation assay, we observed that HAP1-triggered externalization of LAMP1 in TALL-104 cells was markedly reduced when PBRM1 was mutated (Fig. 5G). Likewise, KO of PBRM1 diminished the ability of HAP1 cells to induce LAMP1 externalization in NK cells (Fig. 5H). Thus, PBRM1 is required for triggering cytolytic granule secretion from MHC-unrestricted CLs. We also tested other molecules of CLs involved in target cell killing. We observed that target cellinduced surface expression of TRAIL in TALL-104 cells was reduced when PBRM1 was mutated in HAP1 cells (fig. S12). By contrast, target cellinduced IFN- release was not affected by PBRM1 KO in HAP1 cells (fig. S10). Together, these results demonstrate that PBRM1 regulates ULBP expression in tumor cells and promotes cytolytic granule secretion from MHC-unrestricted CLs.

This work revealed a complex network of tumor-intrinsic factors that positively or negatively regulate the response of tumor cells to NK cells and other clinically significant MHC-unrestricted CLs. Mutations of these factors either cause resistance or enhance sensitivity to killing. The screens identified known genes involved in NK cellmediated killing such as ligands of NK cell receptors. Most of the genes isolated in the screens, however, were not previously linked to tumor killing. Notably, most of our hits including PBRM1 and GPI biosynthetic genes were not recovered in previous attempts to genetically dissect NK cellmediated killing (5658), likely because of the unique genetic screening platform used in this work. The advantages of this platform include homogeneous populations of CLs with consistent tumor-killing activities and a multiround selection procedure that can identify genes with a wide range of KO phenotypes.

A large portion of the genes identified in the screens were mutated in human cancers. Most of these genes do not regulate cell proliferation or response to T cellmediated cytotoxicity, suggesting that their mutations promote cancer progression by impairing NK cellmediated killing of tumor cells. These findings will be valuable for personalized evaluation of cancer genomes and immunotherapeutic strategies. An unexpected discovery of this study is that the genes regulating tumor response to killing are fundamentally distinct between MHC-unrestricted and MHC-restricted CLs. While a subset of our hits including the IFN- receptor and CFLAR are also involved in T cellmediated killing (3335), the vast majority of the genes identified in our screens are unique to tumor response to MHC-unrestricted cytotoxicity. Likewise, most of the genes identified in previous T cellbased screens were not involved in tumor response to killing by MHC-unrestricted CLs. Knowledge of tumor responses to MHC-unrestricted CLs is integral to understanding how tumor cells interact with the immune system and how they evade cancer immunosurveillance to develop into metastatic malignancies.

A major group of genes identified in our screens encode enzymes involved in the biosynthesis of the GPI anchor. We found that mutation of GPI biosynthetic pathway abolishes the surface expression of all ULBPs. This finding indicates that, although certain ULBPs also have transmembrane domains besides the GPI anchor, the GPI anchor is essential for their surface localization. Thus, manipulation of the GPI biosynthetic pathway has the potential to simultaneously target the entire ULBP family of proteins. It is possible that ULBP deficiency fully accounts for the defects of activation and cytotoxic functions of CLs caused by mutations of GPI biosynthesis. However, since cells express nearly 200 GPI-APs (59), it remains possible that additional GPI-APs other than ULBPs are also involved in tumor cells response to killing.

An unexpected finding of this study is that PBRM1 plays opposite roles in MHC-restricted and MHC-unrestricted tumor killing. A tumor suppressor mutated in a number of tumors including clear-cell renal cell carcinoma (31, 32, 35, 54), PBRM1 negatively regulates T cellmediated tumor killing by modulating the expression of cytotoxic signaling molecules (32, 35). While this inhibitory activity correlates well with the clinical benefits of PBRM1 mutations in checkpoint therapies (32, 35), it cannot fully explain the tumor suppressor role of PBRM1. Our findings suggest that PBRM1 mutations promote tumorigenesis by impairing NK cellmediated clearance of tumor cells. PBRM1 regulates surface expression of ULBPs, which are NKG2D ligands. The overall KO phenotype of PBRM1 is remarkably similar to that of PIGP, suggesting that PBRM1 may control the expression, maturation, or localization of a GPI biosynthetic gene(s) rather than individual ULBPs. Further research using human samples and mouse models will be needed to test this possibility.

Both the innate and adaptive immune systems are involved in cancer immunosurveillance, and cancer arises when both systems fail (7, 12). Given the complementary nature of MHC-restricted and MHC-unrestricted CLs in tumor killing, it is conceivable that combinatorial therapies using both types of CLs would achieve the best therapeutic outcomes. NK cells are capable of detecting and eliminating tumor cells refractory to T cellmediated cytotoxicity and are particularly powerful in eradicating metastatic tumor cells and cancer stem cells (1113). To be effective, cancer immunotherapies must overcome resistance to CL-mediated cytotoxicity. The large number of tumor-intrinsic factors identified in this work provides a rich source of potential targets to enhance and maintain the response of tumor cells to endogenous NK cells or engineered NK cells and NK-like cell lines in adoptive transfer therapies.

HAP1 cells were cultured in Iscoves Modified Dulbeccos Medium (IMDM) supplemented with 10% fetal bovine serum (FBS), l-glutamine, and penicillin/streptomycin. 293T cells were cultured in Dulbeccos modified Eagles medium (DMEM) supplemented with 20% FBS, l-glutamine, and penicillin/streptomycin. 786-O cells [American Type Culture Collection (ATCC), no. CRL-1932] were cultured in RPMI 1640 supplemented with 10% FBS, l-glutamine, and penicillin/streptomycin. NK-92 cells (ATCC, no. CRL-2407) were cultured in minimum essential medium Eagle, alpha modification supplemented with 12.5% FBS, 12.5% Donor Equine Serum, 2 mM l-glutamine, 0.2 mM myo-inositol (Acros Organics, no. 122261000), 0.1 mM 2-mercaptoethanol, 0.02 mM folic acid (Acros Organics, no. 216630100), and recombinant human interleukin-1 (IL-2) (100 U/ml) (PeproTech, no. 200-02). TALL-104 cells (ATCC, no. CRL-11386) were cultured in IMDM supplemented with 20% FBS, human albumin (2.5 g/ml) (Sigma-Aldrich, no. A9731), d-mannitol (0.5 g/ml) (Acros Organics, no. 125345000), and recombinant human IL-2 (100 U/ml). Primary NK cells (ZenBio, no. SER-PBCD56 + NK-F) were cultured in RPMI 1640 supplemented with 10% FBS, l-glutamine, penicillin/streptomycin, sodium pyruvate, MEM nonessential amino acids, recombinant human IL-2 (100 U/ml), and recombinant human IL-15 (10 U/ml) (PeproTech, no. 200-15). PBMCs (ZenBio, no. SER-PBMC-200) were cultured in RPMI 1640 supplemented with 10% FBS, l-glutamine, penicillin/streptomycin, sodium pyruvate, and MEM nonessential amino acids. Human ASCs (ZenBio, no. ASC-F) were grown in DMEM/Hams F-12 (1:1) media supplemented with 10% FBS and penicillin/streptomycin.

Mutant HAP1 libraries were produced using a previously described procedure (28). Briefly, gene-trap retroviruses were generated by transfecting six T175 flasks of 293T cells with a cocktail of plasmids including pGT-GFP0, pGT-GFP1, pGT-GFP2, pAdVAntage (Promega, no. E1711), pGAL, and pCMV-VSVG using TurboFectin 8.0 (OriGene, no. TF81001). The retroviruses were collected 40 hours after transfection, and again 50 hours after transfection. The retroviruses were concentrated in a Beckman SW 28 rotor at 25,000 rpm for 1.5 hours. Viral pellets were resuspended in 500 l of phosphate-buffered saline (PBS) overnight at 4C. HAP1 cells (1.5 108) were spin-infected twice at 12-hour intervals with 1.5 viral concentrate (by flask surface area) in the presence of protamine sulfate (8 g/ml). After mixture with virus, cells were plated in 12-well plates at 1.5 106 cells per well and centrifuged at 900g for 1.5 hours at room temperature in a Thermo Fisher Scientific Legend RT+ centrifuge. The multiplicity of infection was kept below 1.0 on the basis of green fluorescent protein (GFP) fluorescence. The GPI-deficient library used in the modifier screen was generated using the above protocol. To produce a mutant library in GPI-APdeficient HAP1 cells, unaltered HAP1 cells were spin-infected with lentiCRISPR virus targeting PIGP (see the Genome editing using CRISPR-Cas9 section). Infected cells were stained for surface CD59 by incubation with anti-CD59 (eBioscience, no. 17-0596) antibodies followed by incubation with allophycocyanin (APC)conjugated anti-mouse secondary antibodies (eBioscience, no. 17-4015) (see the Flow cytometry measurements section). HAP1 cells with low cell size (forward scatter) and lack of surface CD59 protein (APC) were collected by fluorescence-activated cell sorting (MoFlo, Beckman Coulter) to isolate a haploid GPI-AP deficient population. This population was used to produce an additional gene-trap library as described above.

A HAP1 cell library consisting of ~1.5 108 mutagenized cells was thawed and allowed to recover for 3 days. The cells were plated at a density of 5 106 cells per 100-mm plate. One population of 1.5 108 cells was plated for selection, and another population of 1.5 108 cells was plated for passage throughout the duration of the screen. HAP1 cells were incubated with approximately equal numbers of TALL-104 cells in the presence of IL-2 (100 U/ml) and the following inhibitor cocktail: soluble TRAIL-R2-Fc chimera at a final concentration of 20 ng/ml (R&D Systems, no. 631-T2-100), soluble TNFR1p55 at a final concentration of 100 ng/ml (a gift of C. Edwards, University of Colorado School of Medicine), soluble tumor necrosis factor receptor 1 (TNFR1)Fc at a final concentration of 5 ng/ml (R&D Systems, no. 372-RI-050), soluble Fas-Fc chimera at a final concentration of 100 ng/ml (R&D Systems, no. 326-FS-050), and LEAF purified anti-human Fas-L at a final concentration of 50 ng/ml (BioLegend, no. 306409). This inhibitor cocktail was intended to partially inhibit the fast-acting death-receptor killing pathways such that the slower granzyme/perforin cytotoxic pathway could also be reflected in the screen.

The killing and detachment of HAP1 cells were periodically examined until ~50% of the HAP1 cells detached from the plate, which usually took 8 to 12 hours. After treatment, the HAP1 cells were washed once with PBS to remove free TALL-104 cells, and fresh media were added. After 24 hours, the HAP1 cells were dissociated using Accutase (Innovative Cell Technologies, #AT 104), counted, and replated at ~5 106 cells per 100-mm plate for the next round of TALL-104 treatment on the following day. The untreated control cells were split, counted, and replated at a similar total cell number and density as the TALL-104treated HAP1 population. After four rounds of TALL-104 treatment, HAP1 cells were expanded and 5 107 cells were used for genomic DNA extraction and linear polymerase chain reaction (PCR) reactions. The modifier screen using PIGP KO HAP1 cells was completed using a similar protocol as the primary screen, except that HAP1 cells were plated at a density of ~4 106 cells per 100-mm plate and the ratio of TALL-104 to HAP1 cells was approximately 2:1 during treatment.

Genomic DNA was extracted from HAP1 cells using a genomic DNA purification kit (Thermo Fisher Scientific, no. K0721). Linear PCR was performed using 2 g of genomic DNA as template and the following primer: [5-Biotin-GGTCTCCAAATCTCGGTGGAAC-3]. After 125 cycles of amplification, the linear PCR products were purified using biotin-binding Dynabeads (Thermo Fisher Scientific, no. 11047). On-bead ligation of a 5phosphorylated, 3-ddC linker was performed using CircLigase II (Epicentre, no. CL9021K). The product was purified and used as a template for PCR to add Illumina adapter sequences I (5-AATGATACGGCGACCACCGAGATCTGATGGTTCTCTAGCTTGCC-3) and II (5-CAAGCAGAAGACGGCATACGA-3). PCR products from 8 to 30 individual PCR reactions were extracted from a 1% tris-acetate-EDTAagarose gel, pooled over a Qiagen Spin column (Qiagen, no. 28706), and sequenced in a lane of the Illumina HiSeq 2000 using a custom primer recognizing the 5end of the LTR (5-CTAGCTTGCCAAACCTACAGGTGGGGTCTTTCA-3).

FASTQ files from Illumina sequencing were preprocessed to filter duplicate reads using custom scripts. FASTQ files containing unique sequences were aligned to the human genome (hg19) using the Bowtie software v0.12.08 (60). The 50base pair (bp) FASTQ sequences were trimmed from their 3 ends to a length of 35 bp, and were aligned in best mode allowing one mismatch. Reads with more than one genomic alignment were suppressed. Aligned sequences were intersected with gene tables obtained from the University of California, Santa Cruz Genome Browser (hg19) containing either exons or introns using BEDTools software v2.17.0 (61). Unique insertions per gene were counted for exons and for introns. The total numbers of unique sense and antisense insertions within introns were counted for each gene. Fishers exact test was calculated using previously published passage control data (28, 62). We developed custom scripts in Python using NumPy, Pandas, SciPy, and matplotlib modules for downstream data analysis, statistics, and visualization. Heatmaps were generated by normalizing unique insertion counts per gene using the quantile method in R. Normalized values were used as input for heatmap.2 (package gplots) run in R. Insertion plots were produced using the package Gviz in R (www.r-project.org/). GSEA was performed using GSEA from the Broad Institute (36).

Guide sequences were designed according to previously published protocols (63). Double-stranded oligonucleotides containing the guide sequences were individually subcloned into pLentiCRISPR V2-puro vectors as previously described (28, 64). The PIGP gene was mutated using one guide, while the PBRM1 gene was mutated by simultaneous introduction of two independent guide sequences. The following guide sequences were used in this study. The protospacer adjacent motifs are underlined: PIGP: 5-TACAGTACTTTACCTCGTGTGGG-3; PBRM1 exon 1: 5-GAAACCACTTCATAATAGTCTGG-3; PBRM1 exon 4: 5-TTGCAAGCGGCTTTATATTCAGG-3.

Adherent cells were detached from culture plates using Accutase to preserve surface antigens for flow cytometry measurements (6466). Cells were labeled using the indicated mouse monoclonal primary antibodies and APC-conjugated anti-mouse secondary antibodies (eBioscience, no. 17-4015) or Alexa Fluor 488conjugated anti-mouse immunoglobulin G2a secondary antibodies (Invitrogen, #A-21131). Exceptions were phycoerythrin (PE)conjugated anti-CD55 antibodies (eBioscience, no. 12-0559-42), APC-conjugated anti-CD45 antibodies (eBioscience, no. 17-0459-42), APC-conjugated antiHLA-A/B/C antibodies (BioLegend, no. 311409), APC-conjugated anti2-microglobulin antibodies (BioLegend, no. 395711), and eFluor 450conjugated anti-CD69 antibodies (eBioscience, no. 48-0699-41). The following unconjugated primary antibodies were used in this study: anti-CD3 antibodies (eBioscience, no. 14-0038-82), anti-CD56 antibodies (eBioscience, no. 14-0567-82), anti-CD314/NKG2D antibodies (BioLegend, no. 320802), anti-CD337/NKp30 antibodies (BioLegend, no. 325202), anti-PrP antibodies (eBioscience, no. 14-9230), anti-CD59 antibodies (eBioscience, no. 17-0596), anti-CD261/TRAIL-R1 antibodies (eBioscience, no. 14-6644-80), anti-CD262/TRAIL-R2 antibodies (eBioscience, no. 14-9909-82), anti-CD155/PVR antibodies (BioLegend, no. 337602), anti-ULBP1 antibodies (R&D Systems, no. MAB1380), anti-ULBP2/5/6 antibodies (R&D Systems, no. MAB1298), anti-ULBP3 antibodies (R&D Systems, no. MAB1517), anti-LAMP1/CD107a antibodies (eBioscience, no. 14-1079-80), and anti-CD253/TRAIL antibodies (eBioscience, no. 16-9927-82). Flow cytometry data were collected on the CyAn ADP Analyzer (Beckman Coulter). Data from populations of approximately 10,000 cells were analyzed using FlowJo 10.1. All flow cytometry experiments were run in biological triplicate to calculate statistical significance.

Cells were lysed in an SDS sample buffer, and the samples were resolved on 8% bis-tris SDSpolyacrylamide gel electrophoresis. PIGP and PBRM1 were detected using rabbit polyclonal anti-PIGP antibodies (Sino Biological, #204171-T36) and rabbit polyclonal anti-PBRM1/BAF180 antibodies (Bethyl Laboratories, no. A301-591A-T), respectively, and horseradish peroxidaseconjugated anti-rabbit secondary antibodies (Sigma-Aldrich, no. A6154). -Tubulin was probed using mouse monoclonal anti-tubulin antibodies (eBioscience, no. 14-4502-82) and horseradish peroxidaseconjugated anti-mouse secondary antibodies (Sigma-Aldrich, no. A6782).

WT and mutant target cells were mixed at a 1:1 ratio and plated in six-well plates in six replicates at a density of 3.5 105 cells per well. After 24 hours, TALL-104 cells were added to three replicates of target cells at a 1:1 ratio. An additional three replicates were passage controls. After 8 hours, the TALL-104 cells were removed by aspiration and washing with PBS. Target cells attached to the plates were allowed to recover overnight. Subsequently, target cells were collected using Accutase digestion. Approximately half of the collected target cells were plated for an additional round of TALL-104 treatment, while the remaining cells were prepared for flow cytometry measurements. Flow cytometry was used to measure the ratio of WT to mutant target cells in each population.

Target cells were plated at ~105 cells per well in a 24-well plate. After 24 hours, primary human NK cells were stained with APC-conjugated anti-CD45 antibodies and added to target cells at a 1:1 ratio in the presence of IL-2, IL-15, and the inhibitor cocktail. After incubation, both nonadherent and adherent cells were collected using Accutase digestion. The cells were stained with propidium iodide and assayed by flow cytometry.

Target cells were plated at ~105 cells per well in a 24-well plate. After 24 hours, CLs (TALL-104 or NK cells) were added to the target cells at a 1:1 ratio in the presence of IL-2 and the inhibitor cocktail. After incubation for 4 hours, both nonadherent and adherent cells were collected using Accutase digestion. The cells were stained with anti-LAMP1 antibodies (eBioscience, no. 14-1079-80) and PE-conjugated anti-mouse secondary antibodies (BioLegend, no. 406608), as well as APC-conjugated anti-CD45 antibodies (eBioscience, no. 17-0459-42). Only CD45+ CLs were included in the analysis (target cells were CD45). CL degranulation was quantified as the fold change of mean LAMP1 protein surface staining normalized to a CL-only control.

Target cells were plated at ~105 cells per well in a 24-well plate. After 24 hours, CLs (TALL-104 or NK cells) were added to the target cells at a 1:1 ratio in the presence of IL-2. After incubation for 24 hours, both nonadherent and adherent cells were collected using Accutase digestion. The cells were stained with anti-CD253/TRAIL antibodies (eBioscience, no. 16-9927-82), PE-conjugated anti-mouse secondary antibodies, and APC-conjugated anti-CD45 antibodies. TRAIL surface levels on CD45+ CLs were quantified using flow cytometry.

Target cells were plated at ~105 cells per well in a 24-well plate. After 24 hours, CLs were added to the target cells at a 1:1 ratio in the presence of IL-2 and the inhibitor cocktail. After incubation for 48 hours, both nonadherent and adherent cells were collected using Accutase digestion. The cells were stained with eFluor 450conjugated anti-CD69 antibodies (eBioscience, no. 48-0699-41) and APC-conjugated anti-CD45 antibodies. Surface levels of CD69 in CD45+ CLs were quantified using flow cytometry.

Total RNAs were isolated using the RNeasy Mini Kit (Qiagen, no. 74104), followed by treatment with ezDNAse (Thermo Fisher Scientific, no. 18091150). First strand complementary DNA synthesis was performed using a SuperScript IV kit (Thermo Fisher Scientific, no. 18091050). Gene expression was determined by quantitative reverse transcription PCR on a Bio-Rad CFX384 Real-time PCR Detection System using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, no. 172-5272) with gene-specific primer sets. The cycle threshold values of a candidate gene were normalized to those of GAPDH, a reference gene, and the cycle threshold values were calculated. The results were plotted as fold changes relative to the WT sample.

PCR primers for PBRM1 were as follows: CGGGTGTGATGAACCAAGGA (forward) and

TTGGCTGCTGTATGACAGGG (reverse). PCR primers for GAPDH were as follows: GACAGTCAGCCGCATCTTCT (forward) and GCGCCCAATACGACCAAATC (reverse).

Acknowledgments: We thank C. Dinarello, W. Gao, X. Liu, C. Detweiler, L. Lenz, and B. Weaver for advice or reagents. We thank L. Crisman and I. Datta for comments on the manuscript. Funding: This work was financially supported by grants from NIH (GM126960, AG061829, and DK124431 to J.S.; AI128443 to S.L.; AI135473 to H.Y.; GM088759 to B.L.M. and E.M.D.), a Postdoctoral Fellowship from the Postdoctoral Overseas Training Program at Beijing University of Chinese Medicine (S.W.), and seed grants from the Cancer Center and Linda Crnic Institute at University of Colorado (J.S.). Publication of this article was partially funded by the University of Colorado Boulder Libraries Open Access Fund. Author contributions: B.L.M., E.M.D., and J.S. designed the study. B.L.M., E.M.D., S.W., Y.O., and S.L. performed the experiments. B.L.M., E.M.D., S.W., S.L., H.Y., and J.S. analyzed the results and wrote the manuscript. All the authors contributed to the overall scientific interpretation and edited the manuscript. Competing interests: The authors declare that they have no competing interests. Data and materials availability: All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary Materials. Additional data related to this paper may be requested from the authors. All work was carried out at University of Colorado.

Excerpt from:

PBRM1 and the glycosylphosphatidylinositol biosynthetic pathway promote tumor killing mediated by MHC-unrestricted cytotoxic lymphocytes - Science...

Read more
Some Of The Benefits Of Exercise For Those Over 50 – Anti Aging News

It has been well established that exercise is important at any age, but research is showing that exercise may have the most significant impact on older adults. With age, the body undergoes many changes some of which can be degenerative and debilitating to health, but the good news is that exercise can help to slow these age-related issues or better yet it may even help to prevent them from occurring in the first place.

When it comes to healthy ageing exercise really is the closest thing to a miracle there is with its myriad of benefits that come with regular physical activity. Routines with a mix of exercises to increases endurance, balance, strength and flexibility help in many ways, and beyond the physical benefits there are emotional benefits as well. There is a long list of different benefits for adults over the age of 50 who exercise on a regular basis, but there are some that stand out more than others.

Longevity and Independence

Exercise on a regular basis will help older adults maintain their independence later in life, although this is actually a culmination of several benefits. There are several factors that affect the ability to live on your own in elderhood, these factors are not just elements of overall health and wellbeing they are key drivers of healthy longevity. The better you markers the more likely you are to be able to retain and continue to enjoy independence.

A study published in Rejuvenation Research notes that "functional independence is directly dependent on physical fitness," pointing out direct relationships between physical fitness levels in older adults and the risk for muscle loss, cognitive decline, heart disease, and disability which all influence independence and longevity. According to Harvard Health Publishing, exercise does not have to be overly intense, reporting that walking daily can decrease the chances of becoming disabled by 28%.

Heart Health

Heart disease has many forms, and according to the American Heart Association, it is a leading cause of illness and death among older adults. The heart changes with age meaning that you are more likely to have heart problems the older one gets, but exercise can help to fight against the many forms of heart problems. A study published in the Canadian Journal of Cardiology shows that it is never too late to start exercising and that it is most important for older adults.

Exercise strengthens the muscles which includes the heart and it helps to keep weight in check. Keeping the heart healthy is especially important in older years to help avoid heart disease, heart failure, stroke, and other life-threatening diseases. When you exercise your resting heart rate will slow over time and the overall stress on the heart decreases; keeping the heart in shape will help to slow cardiovascular ageing which leads to a more healthy, active life.

Cognitive Decline

A mounting body of significant evidence shows the promise of exercise as a preventive tool against cognitive diseases. Studies show links between physical activity and a reduced risk of dementia. Much of these benefits may be due to the improved circulation to the brain. Exercise affects the brain in many ways such as increasing heart rate and brain oxygenation, increasing hormonal release leading to growth in neurons and their supporting cells, and promoting brain connectivity and plasticity, providing sharper memory and concentration, better sleep, and building better coping mechanisms for future mental and emotional challenges.

A study of brain autopsies published in Neurology associated exercise with a reduced risk of cognitive decline, even in older adults who had brain lesions. Another study published in Mayo Clinic Proceedings associated cardio exercise with higher gray matter volume which helps the brain process information and contributes to sensory perception, decision making, speech and self-control. The Mayo Clinic also reports that those with a history generally have a lower risk of developing cognitive diseases later in life and the earlier one starts exercising the better.

Bone Health

Degenerative skeletal diseases can cause bones to become weak and fragile, this increases the risk of fractures, which is especially true after menopause when bone density can decrease more rapidly. Weight-bearing exercises have been shown to help reduce the risk for bone fractures in old age according to the National Institute of Arthritis and Musculoskeletal and Skin Diseases.

Bone adapts to the stress it is placed under, exercising puts physical stress on the bones which triggers the bones to build new tissues and become denser and stronger. Weight-bearing exercises can include walking, dancing, climbing stairs, jumping rope, hiking, jogging, elliptical walking, yoga, and barre as a shortlist of examples. Resistance training exercises like weight lifting and resistance band exercises are recommended by the National Osteoporosis Foundation. Additionally, posture strengthening and balance exercises may help to reduce the risk of wrist and hip fractures that are commonly associated with osteoporosis.

Balance, Coordination and Fall Prevention

Among those over the age of 65 falls are the leading cause of fatal and nonfatal injuries according to the CDC. The majority of falls are preventable, the most critical elements of a fall prevention strategy are screening for potential safety hazards and regular exercise to improve balance, coordination, and strength of muscles and bones which are important to keep one on their feet.

A report published in Current Trauma Reports found that exercises that promote gait, strength and balance are especially effective at reducing fall risk. Bodyweight resistance training, leg and arm exercises, and walking can help to improve strength and balance. Core exercises are also recommended as a strong core is key to stability and full-body strength.

Mental Health

As people climb higher into elderhood they may battle with increased feelings of depression and loneliness, especially if they have lost many loved ones. 1 in 4 older adults are living with a mental disorder according to the National Council on Aging, and this number is projected to double to an estimated 15 million by 2030. The CDC says that older adults are at an increased risk of depression which is partly due to the increased risk of developing chronic diseases that often occur with mental illness.

According to the American Psychological Association, physical activity helps to improve emotional health as exercise has a direct effect on serotonin, among other happiness chemicals. A study published in Ageing Research Reviews concluded that resistance training, mind-body exercise and aerobic activity can help older adults overcome clinical depression in addition to following other medical treatments. Another study published in GeriPsych found exercise to be a feasible supplemental treatment for depression among older adults.

Muscle Loss/Sarcopenia

Among older adults age-related muscle loss is common, at one point it was thought that nothing could be done for this, but research has shown that you can increase muscle mass at any age. According to a report published in Aging Clinical and Experimental Research the best way to fight sarcopenia is with exercise, and another study published in the Journal of the American Medical Director Association showed that even walking can help to prevent sarcopenia.

On average older adults lose 3-8% of their muscle mass after the age of 30 and the rate is even greater after reaching 60 according to a study published in Current Opinion in Clinical Nutrition and Metabolic Care. A study in Nutrients reported that those with sarcopenia may lose up to 50% of their muscle fibers by the age of 50. Losing muscle mass and strength makes it difficult to function and is a significant threat to independence, thus exercise, weight-bearing exercise, and resistance training becomes more important as we age.

Sleep

When it comes to general health and wellbeing regular exercise is helping in supporting quality sleep which is an important part of both. A report published in PeerJ shows how exercise improved sleep quality and duration, especially in older adults. Even those with chronic insomnia benefit from exercise according to the National Sleep Foundation. Another study published in the Journal of Sleep Research found exercise to be a potential treatment for insomnia reporting "significant reduced insomnia symptom severity."

While there has been some debate over sleep being disrupted with evening exercise according to a study published in Sports Medicine there is no conclusive evidence to support that claim so if you prefer to exercise at night dont let that fear of poor sleep stop you. But according to Harvard Health Publishing if you are exercising at night try to avoid high-intensity exercise too close to your bedtime as it could affect your ability to fall to sleep.

Cancer

According to research, there are direct links between exercise and the prevention of many forms of cancer. But most of the well-established associations stem from observational studies that cant necessarily prove the one factor results in the other, however, the evidence for causality is scientifically strong because there are clear biological pathways to explain the ways in which exercise may positively impact factors that reduce the risk of cancer such as decreased inflammation, balanced hormone production, improved immune function, and improved insulin sensitivity.

A study published in the European Journal of Cancer that included 38 cohort studies showed that physically active women had a lower risk of breast cancer than their inactive counterparts, and those who are physically active can reduce the lifetime risk of breast cancer by 9% if they do at least 150 minutes of vigorous exercise per week. Another study published in the British Journal of Sports Medicine found those with a high level of physical activity lowered their total risk of cancer by 10% compared to inactive counterparts, and physical activity may offer protection specifically against breast and colorectal cancers.

For those just starting an exercise routine, start off slowly and gradually build. Use lighter resistance, fewer reps, and shorter distances which will help you to avoid overworking your muscles and joints while testing how your body will respond to increased activity. Gradually build up, but dont adjust too many factors at once, that way you can monitor what you changed to know where the problem is if anything goes wrong. When you control your workouts you reduce the risk of injury and increase the chances of developing proper techniques as you gradually ramp up your fitness routine.

The US Department of Health and Human Services recommends that adults should engage in 150-300 minutes of moderate-intensity aerobic activity, or 75-100 minutes of vigorous aerobic activity, or the equivalent combination of each intensity every week. In addition, muscle-strengthening activity should be done at least 2 days a week, with balance training in addition to aerobic and muscle-strengthening activity.

Continued here:

Some Of The Benefits Of Exercise For Those Over 50 - Anti Aging News

Read more
Dr Apar Kishor Ganti Outlines the Effectiveness of Lurbinectedin and Benefits Over Competition – AJMC.com Managed Markets Network

Lurbinectedin is being studied in a number of diseases, but in lung cancer it has a more favorable side effect profile compared with topotecan, said Apar Kishor Ganti, MD, University of Nebraska Medical Center.

Lurbinectedin is being studied in a number of diseases, but in lung cancer it has a more favorable side effect profile compared with topotecan, said Apar Kishor Ganti, MD, professor of internal medicine, Division of Oncology & Hematology, University of Nebraska Medical Center.

Are there other tumor types where lurbinectedin seems to hold promise?

So, lurbinectedin is being studied in other diseases like breast cancer, mesothelioma, chronic lymphocytic leukemia, among others. But the difference in these other conditions compared to small cell [lung cancer] is there are other treatment options that are reasonably effective in these other cancers, unlike in small cell, so that's where it becomes much more important in in this particular setting.

One other reason why lurbinectedin may be effective is, like I told you earlier, there is a group of cells that seem to be shielded from chemotherapy. We call them cancer stem cells. And there are some lab data that suggests that lurbinectedin may inhibit cancer stem cells, as well. Again, this is all preliminary data. And we don't necessarily know if that occurs in humans or not, but those are some of the hypothesized mechanisms of action.

What other advantages are there of lurbinectedin over topotecan?

One of the other advantages of lurbinectedin over topotecan is that topotecan has to be given 5 days in a row, whereas lurbinectedin is given just once every 3 weeks. And the side effect profile of lurbinectedin seems to be favorable. The main side effect of lurbinectedin is bone marrow suppression, anemia, leukopenia, neutropenia, [and] thrombocytopenia, but they seem to occur in about 5% to 10% of patients. And so, that's another possible advantage of lurbinectedin over for some of the other drugs that are available.

As far as small cell lung cancer itself is concerned, even though there is a lot of research going on in small cell, multiple different drugs have been triedtargeted therapies, immunotherapythere is some evidence to suggest that immunotherapy helps with chemotherapy in the frontline setting. But immunotherapy by itself in patients who have failed chemotherapy does not seem to be much more effective. People have tried targeted therapies, again, not one of them has shown to have any meaningful benefit for these patients. So that has been very disappointing.

There have been multiple drugs that have been studied. Unfortunately, none of them have had a significant benefit so far. So, it's a fairly difficult to treat disease. And like I mentioned earlier, even though it seems to respond quite well to initial chemotherapymost patients relapse and very few are cured even if they present with very early stage disease. And that's why it's a very challenging disease to treat.

See the rest here:

Dr Apar Kishor Ganti Outlines the Effectiveness of Lurbinectedin and Benefits Over Competition - AJMC.com Managed Markets Network

Read more
Tetracycline-based Antibiotics Show Promise for Combating Zika Infections – Global Biodefense

A widely used antibiotic methacycline was shown effective at preventing brain infections and reducing neurological problems associated with Zika virus in mice models.

National Institutes of Health (NIH) researchers used advanced drug screening techniques to test out more than 10,000 compounds in search of Zika virus therapeutics. The scientists discovered that the widely used antibiotic methacycline was effective at preventing brain infections and reducing neurological problems associated with the virus in mice. Additionally, they found that drugs originally designed to combat Alzheimers disease and inflammation may also help fight infections.

In this study, the researchers looked for drugs that prevent the virus from reproducing by blocking the activity of a protein called NS2B-NS3 Zika virus protease. The Zika virus is a protein capsule that carries long strings of RNA-encoded instructions for manufacturing more viral proteins. During an infection, the virus injects the RNA into a cell, resulting in the production of these proteins, which are strung together, side-by-side, like the parts in a plastic model airplane kit. The NS2B-NS3 protease then snaps off each protein, all of which are critical for assembling new viral particles.

The study was a collaboration between scientists on Dr. Naths team and researchers in laboratories led by Anton Simeonov, Ph.D., scientific director at the NIHs National Center for Advancing Translational Sciences (NCATS) and Radhakrishnan Padmanabhan, Ph.D., Professor of Microbiology & Immunology, Georgetown University Medical Center, Washington, D.C.

The Zika virus is primarily spread by the Aedes aegypti mosquito. In 2015 and 2016, at least 60 countries reported infections. Some of these countries also reported a high incidence of infected mothers giving birth to babies born with abnormally small heads resulting from a developmental brain disorder called fetal microcephaly. In some adults, infections were the cause of several neurological disorders including Guillain-Barr syndrome, encephalitis, and myelitis. Although many scientists have tried, they have yet to discover an effective treatment or vaccination against the virus.

Proteases act like scissors. Blocking protease activity is an effective strategy for counteracting many viruses, said Rachel Abrams, Ph.D., an organic chemist in Dr. Naths lab and the study leader. We wanted to look as far and wide as possible for drugs that could prevent the protease from snipping the Zika virus polyprotein into its active pieces.

To find candidates, Dr. Abrams worked with scientists on Dr. Simeonovs and Dr. Padmanabhans teams to create assays, or tests, for assessing the ability of drugs to block NS2B-NS3 Zika virus protease activity in plates containing hundreds of tiny test tubes. Each assay was tailored to a different screening, or sifting, technique. They then used these assays to simultaneously try out thousands of candidates stored in three separate libraries.

One preliminary screen of 2,000 compounds suggested that commonly used, tetracycline-based antibiotic drugs, like methacycline, may be effective at blocking the protease.

Meanwhile, a large-scale screen of more than 10,000 compounds helped identify an investigational anti-inflammatory medicine, called MK-591, and a failed anti-Alzheimers disease drug, called JNJ-404 as potential candidates. A virtual screen of over 130,000 compounds was also used to help spot candidates. For this, the researchers fed the other screening results into a computer and then used artificial intelligence-based programs to learn what makes a compound good at blocking NS2B-NS3 Zika virus protease activity.

These results show that taking advantage of the latest technological advances can help researchers find treatments that can be repurposed to fight other diseases, said Dr. Simeonov.

The Zika virus is known to preferentially infect stem cells in the brain. Scientists suspect this is the reason why infections cause more harm to newborn babies than to adults. Experiments on neural stem cells grown in petri dishes indicated that all three drugs identified in this study may counteract these problems. Treating the cells with methacycline, MK-591, or JNJ-404 reduced Zika virus infections.

Because tetracyclines are U.S. Food and Drug Administration-approved drugs that are known to cross the placenta of pregnant women, the researchers focused on methacycline and found that it may reduce some neurodevelopmental problems caused by the Zika virus. For instance, Zika-infected newborn mice that were treated with methacycline had better balance and could turn over more easily than ones that were given a placebo. Brain examinations suggested this was because the antibiotic reduced infections and neural damage. Nevertheless, the antibiotics did not completely counteract harm caused by the Zika virus. The weight of mice infected with the virus was lower than control mice regardless of whether the mice were treated with methacycline.

These results suggest that tetracycline-based antibiotics may at least be effective at preventing the neurological problems associated with Zika virus infections, said Dr. Abrams. Given that they are widely used, we hope that we can rapidly test their potential in clinical trials.

Therapeutic Candidates for the Zika Virus Identified by a High Throughput Screen for Zika Protease Inhibitors.PNAS, November 23, 2020

Continue reading here:

Tetracycline-based Antibiotics Show Promise for Combating Zika Infections - Global Biodefense

Read more